MLTUD1096 Display Image

MISSION Lenti microRNA Inhibitor, Mouse, mmu-miR-3087-3p

Code: MLTUD1096 D2-231

General description

Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration w...


read more

Your Price
£514.59 EACH
Discontinued
£617.51 inc. VAT

General description

Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Allows for potent inhibition of the desired miRNALentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell typesEnables long-term inhibition without repeat transfection

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Other Notes

Based on miRBase V19 Mature ID

concentration≥1x106 VP/ml (via p24 assay)
formliquid
mature sequenceUAACUCACUGUCAUGUCCUCA
product lineMISSION®
Quality Level200
Sanger mature/minor accession no.MIMAT0014896
Sanger microRNA accession no.MI0014080
shipped indry ice
storage temp.−70°C
Hazard Class9
Un Number3245
This product has met the following criteria: