MLMIR0878 Display Image

LENTI MIRNA MUS MMU-MIR-1895

Code: MLMIR0878 D2-231

General description

Sigma’;s Mission Lenti-miRs express miRNAs from a common backbone, whose structure meets requirements for accurate Dicer processing and a partially...


read more

Your Price
£488.91 EACH
Discontinued
£586.69 inc. VAT

General description

Sigma’;s Mission Lenti-miRs express miRNAs from a common backbone, whose structure meets requirements for accurate Dicer processing and a partially complementary strand is designed to mimic the base pairing pattern in the backbone structure using a proprietary algorithm. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Each miRNA construct has been cloned and sequence verified. Mature microRNA sequences are obtained from miRBase.Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Other Notes

Based on miRBase V20 Mature ID

Recommended products

Two negative controls are available: NCLMIR001 and NCLMIR002

concentration≥1x106 VP/ml (via p24 assay)
formliquid
mature sequenceCCCCCGAGGAGGACGAGGAGGA
product lineMISSION®
Quality Level200
Sanger mature/minor accession no.MIMAT0007867
Sanger microRNA accession no.MI0008316
shipped indry ice
storage temp.−70°C
Hazard Class6.2
Un Number3373
This product has met the following criteria: